Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113946 |
| Name | oriT_TSM-18|p1  |
| Organism | Staphylococcus epidermidis strain TSM-18 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP093199 (6033..6133 [-], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | 69..70 |
| Conserved sequence flanking the nic site |
GATTGGTCGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_TSM-18|p1
TCATCTGCCGAAACTTTGAATATGACTGTGCCTGCTTTCGTTAAGAAAAAGGCACAAGGCGCTCGATTGGTCGCACCCAAATTGGATCAATCAACGCGACA
TCATCTGCCGAAACTTTGAATATGACTGTGCCTGCTTTCGTTAAGAAAAAGGCACAAGGCGCTCGATTGGTCGCACCCAAATTGGATCAATCAACGCGACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14381 | GenBank | NZ_CP093199 |
| Plasmid name | TSM-18|p1 | Incompatibility group | - |
| Plasmid size | 39051 bp | Coordinate of oriT [Strand] | 6033..6133 [-] |
| Host baterium | Staphylococcus epidermidis strain TSM-18 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |