Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113906 |
| Name | oriT_pKCA9  |
| Organism | Latilactobacillus sakei strain KCA311 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_KF559314 (8246..8283 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pKCA9
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14341 | GenBank | NZ_KF559314 |
| Plasmid name | pKCA9 | Incompatibility group | - |
| Plasmid size | 9096 bp | Coordinate of oriT [Strand] | 8246..8283 [+] |
| Host baterium | Latilactobacillus sakei strain KCA311 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |