Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113883
Name   oriT_pHN84KPC in_silico
Organism   Enterobacter cloacae strain 13E169
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_KY296104 (16249..16347 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_pHN84KPC
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14318 GenBank   NZ_KY296104
Plasmid name   pHN84KPC Incompatibility group   IncR
Plasmid size   39367 bp Coordinate of oriT [Strand]   16249..16347 [-]
Host baterium   Enterobacter cloacae strain 13E169

Cargo genes


Drug resistance gene   tet(A), blaKPC-2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -