Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113880 |
| Name | oriT_pPA2500  |
| Organism | Pseudomonas aeruginosa strain PA2500 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP129686 (2445..2494 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pPA2500
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14315 | GenBank | NZ_CP129686 |
| Plasmid name | pPA2500 | Incompatibility group | IncR |
| Plasmid size | 57082 bp | Coordinate of oriT [Strand] | 2445..2494 [+] |
| Host baterium | Pseudomonas aeruginosa strain PA2500 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |