Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113793 |
| Name | oriT_pCSME411-3  |
| Organism | Staphylococcus epidermidis strain CSMH-411EB |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP129377 (4255..4375 [-], 121 nt) |
| oriT length | 121 nt |
| IRs (inverted repeats) | 53..60, 62..69 (TTGGGGAT..ATCCCCAA) 23..30, 35..42 (ATTTTTTC..GAAAAAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 121 nt
>oriT_pCSME411-3
AGTGGCTAACATGTTAGCCACTATTTTTTCGCTAGAAAAAATCATAAGGGGCTTGGGGATTATCCCCAACAAGCTGGCGCGTCTACCACGTTAGTGGCTAGCAAAGCCAGTGCTTGCCAAA
AGTGGCTAACATGTTAGCCACTATTTTTTCGCTAGAAAAAATCATAAGGGGCTTGGGGATTATCCCCAACAAGCTGGCGCGTCTACCACGTTAGTGGCTAGCAAAGCCAGTGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14228 | GenBank | NZ_CP129377 |
| Plasmid name | pCSME411-3 | Incompatibility group | - |
| Plasmid size | 10430 bp | Coordinate of oriT [Strand] | 4255..4375 [-] |
| Host baterium | Staphylococcus epidermidis strain CSMH-411EB |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |