Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113790
Name   oriT_pR13.1986_4k in_silico
Organism   Salmonella enterica subsp. enterica serovar Infantis strain R13.1986
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP129389 (4608..4667 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pR13.1986_4k
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14225 GenBank   NZ_CP129389
Plasmid name   pR13.1986_4k Incompatibility group   Col440II
Plasmid size   4779 bp Coordinate of oriT [Strand]   4608..4667 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Infantis strain R13.1986

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -