Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113753
Name   oriT_p4MO13m20 in_silico
Organism   Enterobacter asburiae strain MO13m20
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP129504 (5018..5077 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p4MO13m20
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATAATGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14188 GenBank   NZ_CP129504
Plasmid name   p4MO13m20 Incompatibility group   Col440II
Plasmid size   5149 bp Coordinate of oriT [Strand]   5018..5077 [-]
Host baterium   Enterobacter asburiae strain MO13m20

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -