Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113725 |
| Name | oriT_pLBS02 |
| Organism | Latilactobacillus sakei strain WiKim0063 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP022711 (5013..5050 [-], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pLBS02
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14160 | GenBank | NZ_CP022711 |
| Plasmid name | pLBS02 | Incompatibility group | - |
| Plasmid size | 11504 bp | Coordinate of oriT [Strand] | 5013..5050 [-] |
| Host baterium | Latilactobacillus sakei strain WiKim0063 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |