Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113709
Name   oriT_MRSA1369|unnamed1 in_silico
Organism   Staphylococcus aureus strain MRSA1369
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099577 (1899..2137 [-], 239 nt)
oriT length   239 nt
IRs (inverted repeats)      216..221, 231..236  (TTTTTA..TAAAAA)
 170..177, 182..189  (CTATCATT..AATGATAG)
 154..159, 163..168  (TCTGGC..GCCAGA)
 24..30, 44..50  (CTTTTTT..AAAAAAG)
 28..33, 44..49  (TTTTTT..AAAAAA)
 27..32, 44..49  (TTTTTT..AAAAAA)
 26..31, 44..49  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 239 nt

>oriT_MRSA1369|unnamed1
AAGACATTAGTGATAACTGATGTCTTTTTTTTTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATAACTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTACGGAGTTTTTAGAGAAAAATTAAAAATTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14144 GenBank   NZ_CP099577
Plasmid name   MRSA1369|unnamed1 Incompatibility group   -
Plasmid size   16683 bp Coordinate of oriT [Strand]   1899..2137 [-]
Host baterium   Staphylococcus aureus strain MRSA1369

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21