Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113679 |
| Name | oriT_Y7-3|unnamed2 |
| Organism | Klebsiella quasipneumoniae strain Y7-3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP099836 (96435..96483 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_Y7-3|unnamed2
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 95877..119923
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NDO72_RS26855 (NDO72_26855) | 90979..91191 | + | 213 | WP_013023815 | hypothetical protein | - |
| NDO72_RS26860 (NDO72_26860) | 91202..91426 | + | 225 | WP_004152719 | hypothetical protein | - |
| NDO72_RS26865 (NDO72_26865) | 91507..91827 | + | 321 | WP_004152720 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| NDO72_RS26870 (NDO72_26870) | 91817..92095 | + | 279 | WP_004152721 | helix-turn-helix transcriptional regulator | - |
| NDO72_RS26875 (NDO72_26875) | 92096..92509 | + | 414 | WP_013023817 | type II toxin-antitoxin system HigA family antitoxin | - |
| NDO72_RS26880 (NDO72_26880) | 92645..93853 | - | 1209 | WP_015344990 | IS256 family transposase | - |
| NDO72_RS26885 (NDO72_26885) | 94661..95482 | + | 822 | WP_004152492 | DUF932 domain-containing protein | - |
| NDO72_RS26890 (NDO72_26890) | 95515..95844 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| NDO72_RS26895 (NDO72_26895) | 95877..96362 | - | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| NDO72_RS26900 (NDO72_26900) | 96794..97186 | + | 393 | WP_004194114 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| NDO72_RS26905 (NDO72_26905) | 97416..98117 | + | 702 | WP_004194113 | hypothetical protein | - |
| NDO72_RS26910 (NDO72_26910) | 98203..98403 | + | 201 | WP_004194116 | TraY domain-containing protein | - |
| NDO72_RS26915 (NDO72_26915) | 98472..98840 | + | 369 | WP_004194426 | type IV conjugative transfer system pilin TraA | - |
| NDO72_RS26920 (NDO72_26920) | 98854..99159 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| NDO72_RS26925 (NDO72_26925) | 99179..99745 | + | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| NDO72_RS26930 (NDO72_26930) | 99732..100472 | + | 741 | WP_013023821 | type-F conjugative transfer system secretin TraK | traK |
| NDO72_RS26935 (NDO72_26935) | 100472..101896 | + | 1425 | WP_004194260 | F-type conjugal transfer pilus assembly protein TraB | traB |
| NDO72_RS26940 (NDO72_26940) | 102010..102594 | + | 585 | WP_013023822 | type IV conjugative transfer system lipoprotein TraV | traV |
| NDO72_RS26945 (NDO72_26945) | 102726..103136 | + | 411 | WP_009309869 | hypothetical protein | - |
| NDO72_RS26950 (NDO72_26950) | 103242..103460 | + | 219 | WP_015344987 | hypothetical protein | - |
| NDO72_RS26955 (NDO72_26955) | 103461..103772 | + | 312 | WP_015344986 | hypothetical protein | - |
| NDO72_RS26960 (NDO72_26960) | 103839..104243 | + | 405 | WP_004197817 | hypothetical protein | - |
| NDO72_RS26965 (NDO72_26965) | 104619..105017 | + | 399 | WP_013609531 | hypothetical protein | - |
| NDO72_RS26970 (NDO72_26970) | 105089..107728 | + | 2640 | WP_013023824 | type IV secretion system protein TraC | virb4 |
| NDO72_RS26975 (NDO72_26975) | 107728..108117 | + | 390 | WP_004197815 | type-F conjugative transfer system protein TrbI | - |
| NDO72_RS26980 (NDO72_26980) | 108117..108743 | + | 627 | WP_009309871 | type-F conjugative transfer system protein TraW | traW |
| NDO72_RS26985 (NDO72_26985) | 108785..109174 | + | 390 | WP_004194992 | hypothetical protein | - |
| NDO72_RS26990 (NDO72_26990) | 109171..110160 | + | 990 | WP_009309872 | conjugal transfer pilus assembly protein TraU | traU |
| NDO72_RS26995 (NDO72_26995) | 110173..110811 | + | 639 | WP_011977786 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| NDO72_RS27000 (NDO72_27000) | 110870..112825 | + | 1956 | WP_013023827 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| NDO72_RS27005 (NDO72_27005) | 112857..113111 | + | 255 | WP_004152674 | conjugal transfer protein TrbE | - |
| NDO72_RS27010 (NDO72_27010) | 113089..113337 | + | 249 | WP_004152675 | hypothetical protein | - |
| NDO72_RS27015 (NDO72_27015) | 113350..113676 | + | 327 | WP_004152676 | hypothetical protein | - |
| NDO72_RS27020 (NDO72_27020) | 113697..114449 | + | 753 | WP_048337413 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| NDO72_RS27025 (NDO72_27025) | 114460..114699 | + | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| NDO72_RS27030 (NDO72_27030) | 114671..115228 | + | 558 | WP_013214031 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| NDO72_RS27035 (NDO72_27035) | 115274..115717 | + | 444 | WP_013023828 | F-type conjugal transfer protein TrbF | - |
| NDO72_RS27040 (NDO72_27040) | 115695..117074 | + | 1380 | WP_014343487 | conjugal transfer pilus assembly protein TraH | traH |
| NDO72_RS27045 (NDO72_27045) | 117074..119923 | + | 2850 | WP_013609534 | conjugal transfer mating-pair stabilization protein TraG | traG |
| NDO72_RS27050 (NDO72_27050) | 119926..120459 | + | 534 | WP_014343486 | conjugal transfer protein TraS | - |
| NDO72_RS27055 (NDO72_27055) | 120645..121376 | + | 732 | WP_013023830 | conjugal transfer complement resistance protein TraT | - |
| NDO72_RS27060 (NDO72_27060) | 121569..122258 | + | 690 | WP_013023831 | hypothetical protein | - |
Host bacterium
| ID | 14114 | GenBank | NZ_CP099836 |
| Plasmid name | Y7-3|unnamed2 | Incompatibility group | IncFII |
| Plasmid size | 123534 bp | Coordinate of oriT [Strand] | 96435..96483 [-] |
| Host baterium | Klebsiella quasipneumoniae strain Y7-3 |
Cargo genes
| Drug resistance gene | qnrS1, blaCTX-M-3, blaTEM-1B, floR, tet(A), mph(A), sul1, qacE, aadA16, dfrA27, ARR-3, aac(6')-Ib-cr |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |