Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113653 |
| Name | oriT_pSRD478  |
| Organism | Streptococcus suis strain SRD478 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP017089 (3013..3053 [-], 41 nt) |
| oriT length | 41 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | 21..22 |
| Conserved sequence flanking the nic site |
AGTGTAGTGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 41 nt
>oriT_pSRD478
CACATTTACGAAGTAAAGTGTAGTGCGTTACACTTTACATG
CACATTTACGAAGTAAAGTGTAGTGCGTTACACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14088 | GenBank | NZ_CP017089 |
| Plasmid name | pSRD478 | Incompatibility group | - |
| Plasmid size | 3972 bp | Coordinate of oriT [Strand] | 3013..3053 [-] |
| Host baterium | Streptococcus suis strain SRD478 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |