Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113630 |
| Name | oriT_CHC|unnamed2  |
| Organism | Salmonella sp. strain CHC |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OP927716 (5999..6092 [+], 94 nt) |
| oriT length | 94 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 94 nt
>oriT_CHC|unnamed2
CGTCAGTACCGGGTGTCGGGTGGACCCTGACCAGGTGGTAATTGTAAGACGTTGCGCGCGACGGTATTACAATTGCACATCCTGTCCTGTTTTT
CGTCAGTACCGGGTGTCGGGTGGACCCTGACCAGGTGGTAATTGTAAGACGTTGCGCGCGACGGTATTACAATTGCACATCCTGTCCTGTTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14065 | GenBank | NZ_OP927716 |
| Plasmid name | CHC|unnamed2 | Incompatibility group | ColRNAI |
| Plasmid size | 6836 bp | Coordinate of oriT [Strand] | 5999..6092 [+] |
| Host baterium | Salmonella sp. strain CHC |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |