Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113592 |
| Name | oriT_FDAARGOS_535|unnamed6 |
| Organism | Shigella flexneri strain FDAARGOS_535 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP034065 (738..812 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_FDAARGOS_535|unnamed6
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 14027 | GenBank | NZ_CP034065 |
| Plasmid name | FDAARGOS_535|unnamed6 | Incompatibility group | Col440I |
| Plasmid size | 2551 bp | Coordinate of oriT [Strand] | 738..812 [-] |
| Host baterium | Shigella flexneri strain FDAARGOS_535 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |