Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113592
Name   oriT_FDAARGOS_535|unnamed6 in_silico
Organism   Shigella flexneri strain FDAARGOS_535
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP034065 (738..812 [-], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_FDAARGOS_535|unnamed6
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   14027 GenBank   NZ_CP034065
Plasmid name   FDAARGOS_535|unnamed6 Incompatibility group   Col440I
Plasmid size   2551 bp Coordinate of oriT [Strand]   738..812 [-]
Host baterium   Shigella flexneri strain FDAARGOS_535

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -