Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113499 |
| Name | oriT_17YN198|p4  |
| Organism | Leclercia adecarboxylata strain 17YN198 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP106963 (11976..12074 [-], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 26..31, 40..45 (GTGATA..TATCAC) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_17YN198|p4
TTTGTTTTTTTCCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTCCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13934 | GenBank | NZ_CP106963 |
| Plasmid name | 17YN198|p4 | Incompatibility group | IncFIA |
| Plasmid size | 52474 bp | Coordinate of oriT [Strand] | 11976..12074 [-] |
| Host baterium | Leclercia adecarboxylata strain 17YN198 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |