Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113458 |
| Name | oriT_pWL374-3  |
| Organism | Enterobacter roggenkampii strain WL374 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP128621 (3983..4039 [+], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pWL374-3
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13893 | GenBank | NZ_CP128621 |
| Plasmid name | pWL374-3 | Incompatibility group | Col440II |
| Plasmid size | 8239 bp | Coordinate of oriT [Strand] | 3983..4039 [+] |
| Host baterium | Enterobacter roggenkampii strain WL374 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |