Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113437 |
| Name | oriT_EF262|p6  |
| Organism | Klebsiella quasipneumoniae strain EF262 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP092518 (4328..4377 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 6..12, 15..21 (CAAAATT..AATTTTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_EF262|p6
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13872 | GenBank | NZ_CP092518 |
| Plasmid name | EF262|p6 | Incompatibility group | Col440I |
| Plasmid size | 4655 bp | Coordinate of oriT [Strand] | 4328..4377 [-] |
| Host baterium | Klebsiella quasipneumoniae strain EF262 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |