Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113378 |
| Name | oriT_p05-RR-90  |
| Organism | Staphylococcus aureus strain 05-RR-90 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP102973 (12597..12786 [-], 190 nt) |
| oriT length | 190 nt |
| IRs (inverted repeats) | 173..178, 185..190 (AGAAAA..TTTTCT) 176..181, 183..188 (AAAATT..AATTTT) 99..106, 110..117 (TATCTGGC..GCCAGATA) 55..62, 75..82 (GTCTTTTT..AAAAAGAC) 33..39, 44..50 (TGTCACA..TGTGACA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 190 nt
>oriT_p05-RR-90
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGTCATATTTCCCTTATGCTCTTTTTACGGAGTTCTTAGAGAAAAATTGAATTTTCT
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGTCATATTTCCCTTATGCTCTTTTTACGGAGTTCTTAGAGAAAAATTGAATTTTCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13813 | GenBank | NZ_CP102973 |
| Plasmid name | p05-RR-90 | Incompatibility group | - |
| Plasmid size | 16155 bp | Coordinate of oriT [Strand] | 12597..12786 [-] |
| Host baterium | Staphylococcus aureus strain 05-RR-90 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |