Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113339
Name   oriT_S11_VPH_Chula|unnamed4 in_silico
Organism   Salmonella enterica strain S11_VPH_Chula
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP121390 (4481..4539 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_S11_VPH_Chula|unnamed4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACCTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   13774 GenBank   NZ_CP121390
Plasmid name   S11_VPH_Chula|unnamed4 Incompatibility group   Col440II
Plasmid size   5947 bp Coordinate of oriT [Strand]   4481..4539 [-]
Host baterium   Salmonella enterica strain S11_VPH_Chula

Cargo genes


Drug resistance gene   aac(6')-Ib-cr
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -