Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113333 |
| Name | oriT_S10_VPH_Chula|unnamed4  |
| Organism | Salmonella enterica strain S10_VPH_Chula |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP121396 (2697..2755 [+], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_S10_VPH_Chula|unnamed4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACCTAGCGCTAGCGGAGTGTATACTGGCTTA
GGTTTCGGGGCGCAGCCCTGAACCAGTCACCTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13768 | GenBank | NZ_CP121396 |
| Plasmid name | S10_VPH_Chula|unnamed4 | Incompatibility group | Col440II |
| Plasmid size | 5947 bp | Coordinate of oriT [Strand] | 2697..2755 [+] |
| Host baterium | Salmonella enterica strain S10_VPH_Chula |
Cargo genes
| Drug resistance gene | aac(6')-Ib-cr |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |