Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   113327
Name   oriT_pColpVC in_silico
Organism   Salmonella enterica subsp. enterica serovar Heidelberg isolate FT3-7B
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP128264 (1953..2035 [+], 83 nt)
oriT length   83 nt
IRs (inverted repeats)      1..6, 15..20  (GGGGTG..CACCCC)
Location of nic site      _
Conserved sequence flanking the
  nic site    		  _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 83 nt

>oriT_pColpVC
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium

ID   13762 GenBank   NZ_CP128264
Plasmid name   pColpVC Incompatibility group   ColpVC
Plasmid size   2096 bp Coordinate of oriT [Strand]   1953..2035 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Heidelberg isolate FT3-7B

Cargo genes

Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -