Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113287
Name   oriT_pYUYZMCS6 in_silico
Organism   Salmonella enterica subsp. enterica serovar Indiana strain YZ20MCS6
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP098830 (3234..3293 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pYUYZMCS6
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   13722 GenBank   NZ_CP098830
Plasmid name   pYUYZMCS6 Incompatibility group   -
Plasmid size   3373 bp Coordinate of oriT [Strand]   3234..3293 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Indiana strain YZ20MCS6

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -