Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113274 |
| Name | oriT_pTXL1  |
| Organism | Leuconostoc mesenteroides subsp. mesenteroides |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_005702 (2083..2118 [-], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 1..6, 17..22 (CACCAC..GTGGTG) |
| Location of nic site | 18..19 |
| Conserved sequence flanking the nic site |
TGTGTGGTGT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pTXL1
CACCACCAATTTATGTGTGGTGTGTAAGTGCGCATT
CACCACCAATTTATGTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13709 | GenBank | NC_005702 |
| Plasmid name | pTXL1 | Incompatibility group | - |
| Plasmid size | 2665 bp | Coordinate of oriT [Strand] | 2083..2118 [-] |
| Host baterium | Leuconostoc mesenteroides subsp. mesenteroides |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |