Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113211
Name   oriT_pRM055_3 in_silico
Organism   Salmonella enterica subsp. enterica serovar Muenster strain RM055
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117335 (590..646 [+], 57 nt)
oriT length   57 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 57 nt

>oriT_pRM055_3
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   13646 GenBank   NZ_CP117335
Plasmid name   pRM055_3 Incompatibility group   Col440I
Plasmid size   2699 bp Coordinate of oriT [Strand]   590..646 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Muenster strain RM055

Cargo genes


Drug resistance gene   qnrB19
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -