Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113210
Name   oriT_pRM055_2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Muenster strain RM055
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117334 (58487..58585 [+], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_pRM055_2
TTTGTTTTTTTTCTTTTAAATCAGTGCAATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   13645 GenBank   NZ_CP117334
Plasmid name   pRM055_2 Incompatibility group   IncR
Plasmid size   62867 bp Coordinate of oriT [Strand]   58487..58585 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Muenster strain RM055

Cargo genes


Drug resistance gene   dfrA12, aadA2, qacE, sul1, sul2, aph(3'')-Ib, aph(6)-Id, floR
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -