Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113200
Name   oriT_pRM003_2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Derby strain RM003
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117314 (33..92 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRM003_2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   13635 GenBank   NZ_CP117314
Plasmid name   pRM003_2 Incompatibility group   ColRNAI
Plasmid size   6047 bp Coordinate of oriT [Strand]   33..92 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Derby strain RM003

Cargo genes


Drug resistance gene   sul2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -