Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113198 |
| Name | oriT_pRM074_2  |
| Organism | Salmonella enterica subsp. enterica serovar Muenster strain RM074 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117331 (2289..2345 [+], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pRM074_2
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13633 | GenBank | NZ_CP117331 |
| Plasmid name | pRM074_2 | Incompatibility group | Col440I |
| Plasmid size | 2699 bp | Coordinate of oriT [Strand] | 2289..2345 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Muenster strain RM074 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |