Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113195
Name   oriT_pRM019_1 in_silico
Organism   Salmonella enterica subsp. enterica serovar Give strain RM019
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117393 (3013..3073 [+], 61 nt)
oriT length   61 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 61 nt

>oriT_pRM019_1
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   13630 GenBank   NZ_CP117393
Plasmid name   pRM019_1 Incompatibility group   -
Plasmid size   3370 bp Coordinate of oriT [Strand]   3013..3073 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Give strain RM019

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -