Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113195 |
| Name | oriT_pRM019_1  |
| Organism | Salmonella enterica subsp. enterica serovar Give strain RM019 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117393 (3013..3073 [+], 61 nt) |
| oriT length | 61 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 61 nt
>oriT_pRM019_1
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13630 | GenBank | NZ_CP117393 |
| Plasmid name | pRM019_1 | Incompatibility group | - |
| Plasmid size | 3370 bp | Coordinate of oriT [Strand] | 3013..3073 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Give strain RM019 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |