Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 113100
• Name: oriT_10290|pla3
• Organism: Escherichia sp. 10290
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_AP025744 (356..415 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_10290|pla3
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 13535
• GenBank: NZ_AP025744
• Plasmid name: 10290|pla3
• Incompatibility group: ColRNAI
• Plasmid size: 7166 bp
• Coordinate of oriT [Strand]: 356..415 [+]
• Host baterium: Escherichia sp. 10290

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -