Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113100
Name   oriT_10290|pla3 in_silico
Organism   Escherichia sp. 10290
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP025744 (356..415 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_10290|pla3
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   13535 GenBank   NZ_AP025744
Plasmid name   10290|pla3 Incompatibility group   ColRNAI
Plasmid size   7166 bp Coordinate of oriT [Strand]   356..415 [+]
Host baterium   Escherichia sp. 10290

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -