Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 113068 |
| Name | oriT_DSM 15096|unnamed7  |
| Organism | Staphylococcus casei strain DSM 15096 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP125725 (4072..4172 [+], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_DSM 15096|unnamed7
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGAATTTTGTTAAGAAAAAGGCACATGGGAGTCGATTGGTAGCGCCCAAATTTGATAAAGAGACGCGACA
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGAATTTTGTTAAGAAAAAGGCACATGGGAGTCGATTGGTAGCGCCCAAATTTGATAAAGAGACGCGACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 13503 | GenBank | NZ_CP125725 |
| Plasmid name | DSM 15096|unnamed7 | Incompatibility group | - |
| Plasmid size | 13744 bp | Coordinate of oriT [Strand] | 4072..4172 [+] |
| Host baterium | Staphylococcus casei strain DSM 15096 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |