Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   113068
Name   oriT_DSM 15096|unnamed7 in_silico
Organism   Staphylococcus casei strain DSM 15096
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP125725 (4072..4172 [+], 101 nt)
oriT length   101 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 101 nt

>oriT_DSM 15096|unnamed7
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGAATTTTGTTAAGAAAAAGGCACATGGGAGTCGATTGGTAGCGCCCAAATTTGATAAAGAGACGCGACA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   13503 GenBank   NZ_CP125725
Plasmid name   DSM 15096|unnamed7 Incompatibility group   -
Plasmid size   13744 bp Coordinate of oriT [Strand]   4072..4172 [+]
Host baterium   Staphylococcus casei strain DSM 15096

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -