Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 112363 |
| Name | oriT_pPlaYM7902E  |
| Organism | Pseudomonas amygdali pv. lachrymans strain YM7902 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP127050 (7814..7845 [+], 32 nt) |
| oriT length | 32 nt |
| IRs (inverted repeats) | 4..9, 13..18 (GCAAAC..GTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 32 nt
>oriT_pPlaYM7902E
CACGCAAACGAAGTTTGCATAAGTGCGCCCTT
CACGCAAACGAAGTTTGCATAAGTGCGCCCTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 12798 | GenBank | NZ_CP127050 |
| Plasmid name | pPlaYM7902E | Incompatibility group | - |
| Plasmid size | 10027 bp | Coordinate of oriT [Strand] | 7814..7845 [+] |
| Host baterium | Pseudomonas amygdali pv. lachrymans strain YM7902 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |