Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111978
Name   oriT_pCUVET18-1784.5 in_silico
Organism   Serratia nevei strain CUVET18-1784
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP115020 (3339..3398 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pCUVET18-1784.5
GGGTTTCGGGGCGCAGGCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   12413 GenBank   NZ_CP115020
Plasmid name   pCUVET18-1784.5 Incompatibility group   ColRNAI
Plasmid size   4947 bp Coordinate of oriT [Strand]   3339..3398 [-]
Host baterium   Serratia nevei strain CUVET18-1784

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -