Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 111978
• Name: oriT_pCUVET18-1784.5
• Organism: Serratia nevei strain CUVET18-1784
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP115020 (3339..3398 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pCUVET18-1784.5
GGGTTTCGGGGCGCAGGCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 12413
• GenBank: NZ_CP115020
• Plasmid name: pCUVET18-1784.5
• Incompatibility group: ColRNAI
• Plasmid size: 4947 bp
• Coordinate of oriT [Strand]: 3339..3398 [-]
• Host baterium: Serratia nevei strain CUVET18-1784

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -