Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 111926 |
Name | oriT_2022CK-00567|unnamed6 |
Organism | Klebsiella variicola strain 2022CK-00567 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP114360 (256..313 [-], 58 nt) |
oriT length | 58 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_2022CK-00567|unnamed6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 12361 | GenBank | NZ_CP114360 |
Plasmid name | 2022CK-00567|unnamed6 | Incompatibility group | Col440II |
Plasmid size | 3223 bp | Coordinate of oriT [Strand] | 256..313 [-] |
Host baterium | Klebsiella variicola strain 2022CK-00567 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |