Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111901
Name   oriT_pJSA01 in_silico
Organism   Staphylococcus aureus strain JH4899
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP014922 (1255..1489 [+], 235 nt)
oriT length   235 nt
IRs (inverted repeats)      166..172, 179..185  (TCCCCAT..ATGGGGA)
 149..155, 159..165  (ATCTGGC..GCCAGAT)
 107..114, 121..128  (TTTTTATG..CATAAAAA)
 82..88, 93..99  (TGTCACA..TGTGACA)
 24..31, 43..50  (CTTTTTTA..TAAAAAAG)
 36..41, 44..49  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 235 nt

>oriT_pJSA01
AAGACATTAGTGATGACTGATGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACACAATATATTGTGTCACAAAAGTGTGACATTGGAGCTTTTTATGACCCCACATAAAAACATCTCGGATGTCTTGAAATATCTGGCTTTGCCAGATTCCCCATTCGTTGATGGGGACAAATTCCTCTTATGCTCTTACGGAGTTTTTAGGGATAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   12336 GenBank   NZ_AP014922
Plasmid name   pJSA01 Incompatibility group   -
Plasmid size   32580 bp Coordinate of oriT [Strand]   1255..1489 [+]
Host baterium   Staphylococcus aureus strain JH4899

Cargo genes


Drug resistance gene   qacB
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21