Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111891 |
| Name | oriT_p1575-2  |
| Organism | Enterobacter hormaechei strain 1575 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP068289 (831..930 [-], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 80..85, 90..95 (AAAAAT..ATTTTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_p1575-2
TATTCCTTTTTTTTCTTTTAATTCATGTAGTTGCGATGAAAATCGCGGCTGCGTTAGGTGTATGACCATTTAAGGGTTAAAAAATCATCATTTTTGGTAG
TATTCCTTTTTTTTCTTTTAATTCATGTAGTTGCGATGAAAATCGCGGCTGCGTTAGGTGTATGACCATTTAAGGGTTAAAAAATCATCATTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 12326 | GenBank | NZ_CP068289 |
| Plasmid name | p1575-2 | Incompatibility group | - |
| Plasmid size | 1699 bp | Coordinate of oriT [Strand] | 831..930 [-] |
| Host baterium | Enterobacter hormaechei strain 1575 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |