Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111886 |
| Name | oriT_2022CK-00564|unnamed3  |
| Organism | Klebsiella variicola strain 2022CK-00564 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP114167 (2802..2851 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_2022CK-00564|unnamed3
ATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTCGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 12321 | GenBank | NZ_CP114167 |
| Plasmid name | 2022CK-00564|unnamed3 | Incompatibility group | Col440I |
| Plasmid size | 3672 bp | Coordinate of oriT [Strand] | 2802..2851 [+] |
| Host baterium | Klebsiella variicola strain 2022CK-00564 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |