Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111879
Name   oriT_pF3517-5 in_silico
Organism   Citrobacter freundii strain F3517
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP137173 (1669..1728 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pF3517-5
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   12314 GenBank   NZ_CP137173
Plasmid name   pF3517-5 Incompatibility group   Col440I
Plasmid size   2154 bp Coordinate of oriT [Strand]   1669..1728 [-]
Host baterium   Citrobacter freundii strain F3517

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -