Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 111873 |
Name | oriT_pB |
Organism | Salmonella enterica subsp. enterica serovar Enteritidis |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NC_005002 (1080..1152 [+], 73 nt) |
oriT length | 73 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 73 nt
>oriT_pB
GTCGGGGCGAAGCCCTGACCAGGTGGGGAATGTCTGAGCGAGCGTGCGCGGTCCGACATTCCCACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGTGGGGAATGTCTGAGCGAGCGTGCGCGGTCCGACATTCCCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 12308 | GenBank | NC_005002 |
Plasmid name | pB | Incompatibility group | ColpVC |
Plasmid size | 1983 bp | Coordinate of oriT [Strand] | 1080..1152 [+] |
Host baterium | Salmonella enterica subsp. enterica serovar Enteritidis |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |