Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111859 |
| Name | oriT_OLF-SE3-98983-4|intermediate  |
| Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE3-98983-4 isolate OLF-SE3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP011844 (39..99 [-], 61 nt) |
| oriT length | 61 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 61 nt
>oriT_OLF-SE3-98983-4|intermediate
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 12294 | GenBank | NZ_CP011844 |
| Plasmid name | OLF-SE3-98983-4|intermediate | Incompatibility group | - |
| Plasmid size | 3372 bp | Coordinate of oriT [Strand] | 39..99 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE3-98983-4 isolate OLF-SE3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |