Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 111858 |
Name | oriT_OLF-SE3-98983-4|small |
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE3-98983-4 isolate OLF-SE3 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP011845 (1079..1161 [+], 83 nt) |
oriT length | 83 nt |
IRs (inverted repeats) | 1..6, 15..20 (GGGGTG..CACCCC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 83 nt
>oriT_OLF-SE3-98983-4|small
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 12293 | GenBank | NZ_CP011845 |
Plasmid name | OLF-SE3-98983-4|small | Incompatibility group | ColpVC |
Plasmid size | 2096 bp | Coordinate of oriT [Strand] | 1079..1161 [+] |
Host baterium | Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE3-98983-4 isolate OLF-SE3 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |