Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111798
Name   oriT_BB1501_6 in_silico
Organism   Klebsiella quasipneumoniae isolate BB1501
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OV753641 (3067..3116 [-], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      5..12, 15..22  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_BB1501_6
ATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTCGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   12233 GenBank   NZ_OV753641
Plasmid name   BB1501_6 Incompatibility group   Col440I
Plasmid size   3512 bp Coordinate of oriT [Strand]   3067..3116 [-]
Host baterium   Klebsiella quasipneumoniae isolate BB1501

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -