Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111791
Name   oriT_pKqs_12A476_3 in_silico
Organism   Klebsiella quasipneumoniae subsp. similipneumoniae strain 12A476
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP084782 (1416..1475 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pKqs_12A476_3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   12226 GenBank   NZ_CP084782
Plasmid name   pKqs_12A476_3 Incompatibility group   Col440II
Plasmid size   5733 bp Coordinate of oriT [Strand]   1416..1475 [+]
Host baterium   Klebsiella quasipneumoniae subsp. similipneumoniae strain 12A476

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -