Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111772 |
| Name | oriT_pNTT31XS-6k  |
| Organism | Klebsiella aerogenes strain NTT31XS |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP077433 (3599..3759 [-], 161 nt) |
| oriT length | 161 nt |
| IRs (inverted repeats) | 40..45, 49..54 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 161 nt
>oriT_pNTT31XS-6k
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 12207 | GenBank | NZ_CP077433 |
| Plasmid name | pNTT31XS-6k | Incompatibility group | IncQ1 |
| Plasmid size | 6477 bp | Coordinate of oriT [Strand] | 3599..3759 [-] |
| Host baterium | Klebsiella aerogenes strain NTT31XS |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |