Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111594
Name   oriT_pCRP3 in_silico
Organism   Citrobacter rodentium
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_003114 (1185..1259 [-], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pCRP3
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   12029 GenBank   NC_003114
Plasmid name   pCRP3 Incompatibility group   ColRNAI
Plasmid size   3172 bp Coordinate of oriT [Strand]   1185..1259 [-]
Host baterium   Citrobacter rodentium

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -