Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111594 |
| Name | oriT_pCRP3  |
| Organism | Citrobacter rodentium |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_003114 (1185..1259 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_pCRP3
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 12029 | GenBank | NC_003114 |
| Plasmid name | pCRP3 | Incompatibility group | ColRNAI |
| Plasmid size | 3172 bp | Coordinate of oriT [Strand] | 1185..1259 [-] |
| Host baterium | Citrobacter rodentium |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |