Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111577 |
| Name | oriT_pS2122_3 |
| Organism | Salmonella enterica subsp. enterica strain S2122 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP110660 (3599..3759 [-], 161 nt) |
| oriT length | 161 nt |
| IRs (inverted repeats) | 40..45, 49..54 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 161 nt
>oriT_pS2122_3
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 12012 | GenBank | NZ_CP110660 |
| Plasmid name | pS2122_3 | Incompatibility group | IncQ1 |
| Plasmid size | 6477 bp | Coordinate of oriT [Strand] | 3599..3759 [-] |
| Host baterium | Salmonella enterica subsp. enterica strain S2122 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |