Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111553
Name   oriT_pSO21_ColRNAI_5.8 in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain SO21
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP032499 (5776..5835 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pSO21_ColRNAI_5.8
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11988 GenBank   NZ_CP032499
Plasmid name   pSO21_ColRNAI_5.8 Incompatibility group   ColRNAI
Plasmid size   5836 bp Coordinate of oriT [Strand]   5776..5835 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain SO21

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -