Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111527
Name   oriT_pSauR46-2 in_silico
Organism   Staphylococcus aureus strain SauR46
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAHKNQ010000047 (1..176 [+], 176 nt)
oriT length   176 nt
IRs (inverted repeats)      136..143, 148..155  (CTATCATT..AATGATAG)
 119..125, 129..135  (GTCTGGC..GCCAGAC)
 51..58, 63..70  (GTGTCACA..TGTGACAC)
 20..26, 31..37  (TGTCACA..TGTGACA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 176 nt

>oriT_pSauR46-2
TGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAACGCAATATATTGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11962 GenBank   NZ_JAHKNQ010000047
Plasmid name   pSauR46-2 Incompatibility group   -
Plasmid size   3050 bp Coordinate of oriT [Strand]   1..176 [+]
Host baterium   Staphylococcus aureus strain SauR46

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -