Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111507
Name   oriT_pSFxv_5 in_silico
Organism   Shigella flexneri 2002017
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_017330 (612..897 [+], 286 nt)
oriT length   286 nt
IRs (inverted repeats)      247..252, 255..260  (CGCCCC..GGGGCG)
 130..138, 148..156  (GCGGTGTTG..CAACACCGC)
 31..38, 41..48  (GCAAAAAC..GTTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 286 nt

>oriT_pSFxv_5
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAAAACATTATCTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11942 GenBank   NC_017330
Plasmid name   pSFxv_5 Incompatibility group   ColRNAI
Plasmid size   3180 bp Coordinate of oriT [Strand]   612..897 [+]
Host baterium   Shigella flexneri 2002017

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -