Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 111489
• Name: oriT_pWP4-W18-ESBL-05_3
• Organism: Klebsiella sp. WP4-W18-ESBL-05
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_AP022060 (2241..2300 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pWP4-W18-ESBL-05_3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTAGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 11924
• GenBank: NZ_AP022060
• Plasmid name: pWP4-W18-ESBL-05_3
• Incompatibility group: ColRNAI
• Plasmid size: 4938 bp
• Coordinate of oriT [Strand]: 2241..2300 [-]
• Host baterium: Klebsiella sp. WP4-W18-ESBL-05

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -