Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111427
Name   oriT_pPNCS014881.4 in_silico
Organism   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014881
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP044965 (1667..1726 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pPNCS014881.4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11862 GenBank   NZ_CP044965
Plasmid name   pPNCS014881.4 Incompatibility group   Col440I
Plasmid size   1888 bp Coordinate of oriT [Strand]   1667..1726 [-]
Host baterium   Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014881

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -