Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111426
Name   oriT_pVB3338_P10 in_silico
Organism   Enterococcus faecium strain VB3338
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP062275 (457..633 [-], 177 nt)
oriT length   177 nt
IRs (inverted repeats)      91..97, 107..113  (ATTTTTT..AAAAAAT)
 92..98, 105..111  (TTTTTTG..CAAAAAA)
 28..34, 37..43  (CCTTCCT..AGGAAGG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 177 nt

>oriT_pVB3338_P10
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGCGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11861 GenBank   NZ_CP062275
Plasmid name   pVB3338_P10 Incompatibility group   -
Plasmid size   2056 bp Coordinate of oriT [Strand]   457..633 [-]
Host baterium   Enterococcus faecium strain VB3338

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -